ENVIRONMENTAL MICROBIOLOGY
Ecological Characterisation of the Colonic Microbiota
in Arctic and Sub-Arctic Seals
Trine Glad & Vibeke Fam Kristiansen &
Kaare M. Nielsen & Lorenzo Brusetti &
André-Denis G. Wright & Monica A. Sundset
Received: 16 October 2009 / Accepted: 16 May 2010 / Published online: 4 June 2010
# Springer Science+Business Media, LLC 2010
Abstract Dominant colonic bacteria in wild hooded (n=9),
harbour (n=1) and grey (n=1) seals were identified using
16S rRNA gene clone libraries (313 clones), revealing
52.7% Bacteroidetes, 41.5% Firmicutes, 4.5% Proteobacteria
and 1.0% Fusobacteria. Thirty (77%) of the 39
phylotypes identified were novel, showing <97% sequence
similarity to their nearest cultivated relatives. Mean colonic
bacterial cell density, determined by real-time PCR, was
high (12.8 log10 cells/g wet wt) for the hooded seals,
while the number of methanogenic Archea was low
(4.0 log10 cells/g wet wt). The level of ampicillin (ampr)
and tetracycline-resistant (tetr) isolates was investigated by
cultivation. Aerobic ampr isolates were only detected in
colon contents from four hooded seals, whereas aerobic
tetr isolates were found in seven of the nine hooded seals.
These data provide novel insight to the gut microbiota of
Arctic and sub-Arctic seals living in the wild.
Introduction
Hooded seals (Cystophora cristata) are deep-diving pinnipeds
found in the Arctic and sub-Arctic North Atlantic.
They feed on a variety of fish and invertebrates, including
Greenland halibut, redfish, herring, polar cod, squid, and
crustaceans [24, 43], and have at times been hunted
intensively both in Canada and Norway. One of three
major breeding sites is the Greenland Sea near Jan Mayen,
where they gather together in late March for breeding and
then reappear in the drift ice to moult in July. Between
pupping and moulting, they make long individual trips
away from the ice edge, mostly to open water. Sometimes,
they visit coastal areas, either the Faeroe Islands, Norway
or Iceland [15]. Harbour seals (Phoca vitulina), also known
as common seals, are the most wide ranging of the
pinnipeds; still, little is known on their biology. They exist
in northern parts of the Pacific Ocean and the Atlantic
Ocean, along the Norwegian coast, on Kola and the west
side of Svalbard [4, 25]. Their diet varies with the type of
prey found in the different habitats. In northern Norway,
they eat mainly fish like saithe, cod, herring, and sculpin
[3]. The harbour seals may interact with local fisheries and
fish farms, thereby being exposed to human activities [26].
Grey seals (Halichoerus grypus) are found only in the
T. Glad : V. F. Kristiansen : K. M. Nielsen
Department of Pharmacy, University of Tromsø,
9037 Tromsø, Norway
V. F. Kristiansen
e-mail: vibekefk@gmail.com
K. M. Nielsen
e-mail: kaare.nielsen@uit.no
T. Glad (*) : V. F. Kristiansen : M. A. Sundset
Department of Arctic and Marine Biology, University of Tromsø,
9037 Tromsø, Norway
e-mail: trine.glad@uit.no
M. A. Sundset
e-mail: monica.a.sundset@uit.no
K. M. Nielsen
GenØk-Center for Biosafety, Research Park,
9294 Tromsø, Norway
L. Brusetti
Faculty of Science and Technology,
Free University of Bozen/Bolzano,
39100 Bolzano, Italy
e-mail: lorenzo.brusetti@unibz.it
A.-D. G. Wright
Department of Animal Science, University of Vermont,
Burlington, VT 05405, USA
e-mail: andre.wright@uvm.edu
Microb Ecol (2010) 60:320–330
DOI 10.1007/s00248-010-9690-x
North Atlantic with three main groups located in the
Northeast Atlantic, the Northwest Atlantic and the Baltic
Sea. The Northeast Atlantic population is centred around
the British Isles, ranging from Iceland, eastward along the
coast of France, and north to Norway and the Kola
peninsula [7]. The population along the Norwegian coast
consists of only 5,800 to 6,600 individuals [39]. Grey seals
are also exposed to human activities through interaction
with local fisheries and fish farms, and their diet is
dominated by fish like cod, saithe, sandeel, herring and
catfish [23, 37].
As would be expected from their diet, seals have a
typical carnivorous gastrointestinal tract, consisting of a
single stomach, a small intestine, a rudimentary caecum and
a short simple colon [38, 40]. The length of the small
intestine differs greatly among different species (five to 25
times body length), but the reason for this is presently
unknown [38]. The digestive tract of mammals harbours a
complex microbial ecosystem with representatives from all
domains of life (Bacteria, Archaea and Eucarya) [56]
playing a key role in the nutrition and health of the animal.
Molecular methods enable us to study the large community
of bacteria and methanogenic archaea that we are not able
to cultivate. Avoiding the cultivation bias, these methods
yield a more detailed insight into the diversity and
characteristics of the intestinal ecosystems. The colon is a
major site of microbial colonisation in mammals, while
colonisation of the foregut occurs in specialised herbivores
such as ruminants. Although the gut microbial ecosystem of
humans and domestic animals, such as ruminants, has been
studied in great detail, the microbial ecology of the
gastrointestinal tract of most wildlife and particularly
animals living in remote and pristine environments such
as the Arctic is still unknown. We have recently published a
study on wild polar bears sampled in their natural
environment in Svalbard and shown that the faecal bacterial
diversity was very low in these animals with the majority of
the obtained sequences affiliated to the genus Clostridium
[19]. Similarly, based on a recent comparative study on
faecal bacterial communities in different mammals, we
expected a low bacterial diversity also in the carnivorous
seals compared with omnivorous and herbivorous animals
[34]. Methanogenic archaea in the digestive tract produce
methane as a by-product of fermentation. Methane has a
global-warming potential 25 times more potent than carbon
dioxide and is consequently one of the most important
greenhouse gases [16]. Methane emissions from monogastric
animals are generally lower than those from ruminants
[28], but data on gut methanogenic archaea in monogastric
animals are scarce. A recent study showed elevated
methane emission rates from seal excreta of five different
Antarctic pinnipeds indicating that seals may indeed also
harbour these prokaryotes in their gut [59].
Antibiotic-resistant bacteria are known to be present also
in populations located in environments that seem not to
have been exposed to the selective pressure of pharmaceutically
produced antibiotics [36, 47]. Nevertheless, isolates
found in habitats utilised by humans are more likely to be
resistant than isolates in pristine areas without human
impact [18, 30, 42]. Some of the most common resistance
genes in clinical settings are the blaTEM genes, which
encode high-level resistance to certain β-lactam antibiotics
[35, 48] such as ampicillin (ampr). The β-lactam antibiotics
are amongst the most widely used agents in clinical and
veterinary practice, and resistance to these agents is
commonly observed in clinical settings [48]. Few studies
have determined the non-clinical distribution of this
important gene, including the gastrointestinal tract of free
ranging Arctic wild mammals [8, 9, 18, 19, 42]. Tetracycline
has been widely used in human and veterinary
medicine, in animal production and in aquaculture. In
aquaculture, tetracycline has been used to prevent and treat
bacterial diseases of fish. This has led to a high prevalence
of tetracycline-resistant bacteria in aquaculture sites [17, 22,
29]. As is the case with ampicillin resistance, little is known
about the prevalence of tetracycline resistance in the
gastrointestinal tract of free-ranging Arctic wild mammals.
The objectives of this study were (1) to do a cultureindependent
characterisation of the gastrointestinal microbiota
in the colon of Arctic and sub-Arctic seals including
hooded, harbour and grey seals, through 16S rRNA gene
cloning and DNA sequencing; (2) to determine the densities
of bacteria and methanogenic archaea in the colon contents
from one of these seal species (the hooded seals) using realtime
PCR quantification; and (3) to examine the prevalence
of ampr (blaTEM alleles) and tetr isolates in the gut focusing
mainly on the hooded seals having the lowest degree of
contact with humans, through limited interaction with local
fisheries and fish farms.
Materials and Methods
Colonic Sampling
Colon contents were collected from nine female hooded
seals that were culled for a range of scientific experiments
in large hooded seal breeding colonies on the pack ice of
the Greenland Sea (72° N, 11° E) (Fig. 1, Table 1). Culling
occurred in conjunction with expeditions on the Norwegian
research vessel “Jan Mayen” in March–April 2004, under
permits issued by Norwegian and Greenland authorities.
Colon contents were also collected from one harbour seal
and one grey seal captured outside Ringvassøy in Troms
(70° N, 19° E), northern Norway (Fig. 1, Table 1).
Anaerobic and aerobic cultivation studies of the colon
Colonic Microbiota in Arctic and Sub-Arctic Seals 321
contents from hooded seals were initiated within 15 min of
removing the colon from the animal. The colon contents
from the harbour and grey seals were collected immediately
after the animals were harvested, kept on ice during transport
to the laboratory and stored at −70°C until analysed.
Bacterial Diversity
Three 16S rRNA gene clone libraries were generated to
characterise the bacterial diversity in the colon of the seals.
One library was prepared from DNA extracted from colon
contents from seven hooded seals. A second library was
made from the colon contents from the harbour seal and a
third library from the colon contents from the grey seal.
Total genomic DNA was extracted using the QIAmp
DNA stool kit (Qiagen, Solna, Sweden) according to the
protocol provided by the manufacturer, and DNA was
quantified using a NanoDrop® ND-1000 Spectrophotometer
(260 nm) (Thermo Fisher Scientific, Waltham, USA).
The 16S rRNA genes were amplified using forward and
reverse primers 27F and 1494R (Table 2), in a reaction
mixture containing 1× HotStartTaq DNA master mix
(Qiagen), 0.3 μM of each primer and 20 ng of extracted
DNA solution in a final volume of 50 μl. PCR amplification
was initiated by denaturation at 95°C for 15 min and
then 30 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for
2 min, with a final extension at 72°C for 10 min. The 16S
rRNA gene amplifications were cloned using the TOPO TA
Cloning® Kit for Sequencing (Invitrogen, CA, USA) and
One Shot® Competent Escherichia coli (TOP10) cells
(Invitrogen). The 16S rRNA gene amplifications from
hooded seals were pooled before cloning. Positive clones
were randomly selected, and recombinant plasmids were
extracted using QIA prep spin miniprep kit (Qiagen).
Extracted DNA was again quantified using the NanoDrop®
Spectrophotometer, and the cloned DNA was sequenced on
a Genetic analyzer (Applied Biosystems, Foster City, USA)
using the ABI BigDye Terminator chemistry. The sequencing
primers used were M13 forward primer, M13 reverse
primer and the universal bacterial 16S rRNA primer
Bact338 (Table 2).
The 16S rRNA sequences were assembled using the
programme Lasergene™ Seqman v. 7.1.0. (DNASTAR
Inc.). Putative chimeric sequences were evaluated using
the chimeric detection programme Bellerophon [27]. The
number of PCR cycles was reduced to a minimum, as the
frequency of formation of chimeric molecules increases
with the number of PCR cycles [54]. We used 30 cycles for
the amplification of the 16S rRNA genes and did not detect
any chimaeras. The generated sequences were first classified
using the RDP II (Classifier: Naive Bayesian rRNA
Classifier Version 1.0, Nov. 2003; the nomenclature
taxonomy of Garrity and Lilburn, release 6.0) and then
compared with GenBank sequences using BLAST (Basic
Local Alignment Search Tool). The 16S rRNA gene
sequences were automatically aligned by CLUSTAL-W in
the software package BioEdit (v. 5.0.9) to give a uniform
length. Phylogenetic analysis was performed using the
neighbour-joining method with the Kimura 2-parameter
correction model in the software MEGA (v. 4.0). Statistical
significance of branching was verified by bootstrapping
involving construction and analysis of 1,000 trees from the
data set in the software MEGA. Sequences were assigned to
operational taxonomic units (OTUs)/phylotypes based on a
97% sequence identity criterion. Standard diversity and
richness indices, including the Shannon index (a nonpara-
Figure 1 Map of the sampling area
Table 1 Seals sampled in this study
Seal species Seal no. Sex Date of sampling
Hooded seal 1 F 25.03.2004
2 F 27.03.2004
3 F 28.03.2004
4 F 29.03.2004
5 F 30.03.2004
6 F 31.03.2004
7 F 01.04.2004
8 F 02.04.2004
9 F 02.04.2004
Harbour seal 10 M 28.04.2006
Grey seal 11 F 19.05.2006
322 T. Glad et al.
metric diversity index combining estimates of richness, i.e.
total numbers of ribotypes) and evenness (relative abundance
of each OTU, indicating diversity) and the Chao1
index (a nonparametric estimator of the minimum OTU
richness) were calculated using the FastGroupII web-based
bioinformatics platform for analyses of 16S rRNA gene
based libraries. The coverage of the clone library was
calculated with the formula [1−(n/N)], where n is the
number of phylotypes represented by one clone, and N is
the total number of clones [21]. The sequence data for the
clones have been submitted to the GenBank/EMBL/DDBJ
database (NCBI) with accession numbers GQ867276 to
GQ867588. The 16S rRNA gene clone libraries from the
seals were compared with other 16S rRNA gene libraries
using The Ribosomal Database Project that allows microbial
community comparison based on 16S rRNA gene
sequence libraries and puts the differences in a taxonomic
context (Classifier: Naïve Bayesian rRNA Classifier Version
2.0, July 2007; the taxonomic outline for bacteria and
archaea, release 7.8) [10, 55].
Microbial Densities
The density of bacteria and methanogenic archaea was
determined by quantitative real-time PCR as previously
described by Sundset et al. [50] using the 16S rRNA gene
primers 1114F and 1275R for bacteria [12] and qmcrA-F
and qmcrA-R primer targeting the methyl-coenzyme M
reductase subunit for methanogenic archaea [13]. The
external standards used for the real-time PCR amplifications
have been previously validated for bacteria [12] and
methanogenic archaea [13].
Viable Counts
Colony-forming units (cfu) were determined for anaerobic
and aerobic heterotrophic bacteria, and ampicillin- (ampr)
and tetracycline-resistant (tetr) anaerobic and aerobic
bacteria. Anaerobic heterotrophic bacteria were grown in
Hungate anaerobic culture tubes (Bellco Glass, Vineland,
USA) with M8S agar, which is based on the media M8Was
described by Olsen et al. [41]. The M8S media was made
with 0.1% (wt/vol) carbohydrates instead of 0.2% and a
fatty acid mix instead of sheep rumen fluid [52]. Aerobic
heterotrophic bacteria were grown on chocolate agar (agar,
horse blood, glucose, Vitox SR 090A, Vitox, SR 090H
[Oxoid]; University Hospital of North Norway, Tromsø,
Norway). Anaerobic ampr bacteria were selected in M8S
agar supplemented with 50 mg/l of ampicillin (Sigma), tetr
bacteria on M8S supplemented with 10 mg/l tetracycline
(Sigma) and aerobic-resistant bacteria on chocolate agar
with the same antibiotic concentrations. Samples were
diluted in 0.9% saline in series of 1:10 and enumerated
after 72 h of incubation at 37°C. Means and standard
deviations for the cfu were calculated on the basis of five
replicates for each of the samples analysed.
PCR Amplification of Potential blaTEM Genes in ampr
Isolates
The absence of PCR inhibitory substances in the DNA
extracted from ampr isolates was tested by running 16S
rRNA gene PCRs on DNA extracted from single isolates by
the boiling lysis method [20]. Total genomic DNA was
extracted by using the QIAmp DNA stool kit (Qiagen)
according to the manufacturer’s instructions and quantified
using a NanoDrop® Spectrophotometer. The general suitability
of DNA for PCR was confirmed with amplification
of the 16S rRNA gene, using the primers 27F and 1494R
(Table 2). The amplification was performed as explained
above, with the following conditions: denaturation at 95°C
for 15 min and then 5 cycles of 94°C for 4 min, 50°C for
45 s, and 72°C for 1 min, and then 30 cycles of 92°C for
45 s, 55°C for 45 s and 72°C for 1 min, with a final
extension at 72°C for 10 min.
The amplification of blaTEM alleles in individual
bacterial isolates was performed in a reaction mixture
containing 1× HotStartTaq DNA master mix (Qiagen),
0.2 μM of each primer and 2 μl of the crude DNA solution
in a final volume of 30 μl. Reactions were denatured at 95°C
for 15 min and then subjected to 30 cycles of 94°C for 45 s,
61°C for 45 s and 72°C for 1 min, with a final extension at
72°C for 10 min. For all blaTEM PCR analyses, the primers
BlaF and BlaR (Table 2) were used to amplify a product of
828 bp (TEM-1 allele of Escherichia coli). The following
controls were used: five strains of E. coli carrying the bla
alleles TEM-1, TEM-3, TEM-6, TEM-9 and TEM-10 as
positive controls, and one strain carrying the SHV-2 allele
Name Primer sequence (5′–3′) Gene target Reference
BlaF CATTTCCGTGTCGCCCTTATTCC blaTEM [14]
BlaR GGCACCTATCTCAGCGATCTGTCTA blaTEM [14]
27F AGAGTTTGATCCTGGCTCAG 16S rRNA [31]
1494R CTACGGCTACCTTGTTACGA 16S rRNA [31]
Bact338 GCTGCCTCCCGTAGGAGT 16S rRNA [2]
Table 2 Primers used for PCR
amplification and sequencing
of bacterial DNA
Colonic Microbiota in Arctic and Sub-Arctic Seals 323
as negative control. The specificity of the primers was
confirmed by in silico amplification and by aligning the
primer binding region of approximately 100 sequence
polymorphic blaTEM alleles [8].
Results
Bacterial Diversity
A total of 313 16S rRNA gene clones were obtained, 160
clones from hooded seals, 77 clones from a harbour seal and
76 clones from a grey seal (Table 3). None of the sequences
were identified as possible chimaeras. The distribution of
sequence affiliation for the 313 clones is presented in Fig. 2.
Overall, 39 phylotypes were identified from the 313 clones
(Table 4), with the Chao1 index estimating the population
richness to be 57 phylotypes (Table 3). The 39 phylotypes
were affiliated with the phyla Firmicutes (58%), Bacteroides
(21%), Proteobacteria (13%) and Fusobacteria (8%)
(Fig. 3). The most abundant phylotype contained 22% of
the 313 sequences, and the nearest relative was Bacteroides
plebeius with a sequence identity of 95%. Of the 39
phylotypes, 30 (77%) were novel, showing <97% sequence
similarity to their nearest cultivated relatives (Table 4).
Bacterial Counts and Antibiotic Resistance
The anaerobic heterotrophic cell counts for the hooded
seal samples ranged between 9.4 and 10.2 log10 cfu/ml.
The aerobic heterotrophic cell counts for the hooded seal
samples ranged between 5.8 and 9.5 log10 cfu/ml and were
5.2 log10 and 4.3 log10 cfu/g for the harbour seal and the
grey seals, respectively (Table 5). The mean bacterial cell
density for the hooded seals, as determined by real-time
PCR, was 12.8 log10 cells/wet weight (wt), and the mean
methanogen cell density was 4.0 log10 cells/wet wt
(Table 6).
No anaerobic ampr or tetr isolates were detected in the
colon content from hooded seal after 72 h of incubation.
However, in one of the five parallel analysis of the colon
content from one hooded seal, more than 100 ampr
colonies were observed after 96 h of incubation. Further,
no aerobic ampr isolates were detected in the colon
content from harbour and grey seals, but they were
detected in four of the hooded seal samples, with numbers
ranging from 2.2 to 4.2 log10 cfu/ml. The prevalence of
aerobic tetr isolates were determined only for the hooded
seal samples, and isolates were detected in seven of the
nine samples, with numbers ranging from 2.7 to
3.5 log10 cfu/ml (Table 5).
Table 3 Statistical analyses of the 16S rRNA gene libraries obtained from colon contents of hooded seals (WSp/S7 clones), harbour seal (CSH
clones) and grey seal (CSG clones) off the coast of northern Norway
Library Valid sequences (n) OTUs (n) Chao 1a Shannon–Wiener indexb Coverage (%)c
Hooded seal (WSP/S7) 160 28 43 2.64 93
Harbour seal (CSH) 77 12 15 1.76 95
Grey seal (CSG) 76 20 22 2.59 93
Combined 313 39 57 2.92 96
a Chao1 is a nonparametric estimator of the minimum richness in a sample used to predict the total number of OTU present
b The Shannon index is a nonparametric diversity index that combines estimates of richness (total numbers of ribotypes) and evenness (relative abundance
of each ribotype) indicating diversity
c According to Good [21]
Figure 2 Pie charts showing
the distribution of sequence affiliation
in a the hooded seal
16S rRNA gene library (WSp/
S7 clones), b the harbour seal
library (CSH clones) and c the
grey seal library (CSG clones)
324 T. Glad et al.
Detection of blaTEM Genes in ampr Isolates and Total
Genomic DNA Extracts
The absence of PCR inhibitory substances in the DNA
extracted from ampr isolates was tested by running 16S
rRNA gene PCR on extracted DNA from each of 77
aerobic and 15 anaerobic single isolates. All amplifications
were positive, indicating that bacterial DNA was amplifiable
in the samples. Subsequently, 77 aerobic ampr isolates
from hooded seal samples were screened for the presence of
blaTEM genes with primers designed for the TEM-1 allele
and derivatives [8], and all amplifications were negative.
Table 4 Combined 16S rRNA gene clones from hooded seals (WSp/S7 clones), harbour seal (CSH clones) and grey seal (CSG clones),
representing in total 39 phylotypes
Phylotype GeneBank
acc. no
No. of
sequences
Size (bp) Nearest relative Sequence
similarity (%)
WSp191 GQ867404 68 1,452 Bacteroides plebeius (AB200217) 95
WSp153 GQ867386 34 1,458 Bacteroides plebeius (AB200217) 95
CSG71 GQ867498 26 1,459 Clostridium amygdalinumm (AY353957) 94
WSp128 GQ867365 23 1,473 Faecalibacterium sp. (EU728785) 94
WSp159 GQ867390 22 1,453 Alistipes finegoldii (AY643082) 95
WSp132 GQ867369 17 1,470 Prevotella sp. (AY349400) 90
CSG81 GQ867507 14 1,450 Blautia producta (AB196512) 95
CSG31 GQ867462 11 1,440 Clostridium perfringens (Y12669) 98
WSp46 GQ867311 10 1,478 Prevotella sp. (AY349402) 91
S7_25 GQ867416 9 1,506 Escherichia coli (EU014689) 99
WSp130 GQ867367 8 1,478 Uncultured Ruminococcaceae (EU794190) 96
WSp42 GQ867307 8 1,455 Faecalibacterium prausnitzii (AY169429) 92
CSG43 GQ867472 6 1,391 Clostridium hiranonis (AB023971) 97
CSG42 GQ867471 5 1,292 Uncultured (DQ394596) 88
CSG52 GQ867481 5 1,374 Bacteroides coprocola (AB200225) 94
WSp183 GQ867399 5 1,492 Bacteroides plebeius (AB200217) 94
WSp96 GQ867346 4 1,479 Alistipes finegoldii (AY643082) 94
CSG70 GQ867497 3 1,452 Faecalibacterium prausnitzii (AY169429) 93
CSG78 GQ867505 3 1,455 Eubacterium contortum (EU980608) 95
CSH65 GQ867560 3 1,472 Clostridium lactatifermentans 96
S7_38 GQ867424 3 1,469 Anaerobiospirillum succiniciproducens (NR_026075) 98
WSP180 GQ867397 3 1,493 Oscillibacter valericigenes (AB238598) 94
WSp28 GQ867298 3 1,471 Ruminococcus bromii (X85099) 88
CSG67 GQ867495 2 1,431 Clostridium hiranonis (AB023971) 97
CSH97 GQ867588 2 1,472 Eubacterium desmolans (L34618) 95
WSp170 GQ867394 2 1,504 Phascolarctobacterium faecium (X72867) 93
WSp87 GQ867340 2 1,470 Ruminococcus gnavus (X94967) 99
CSG65 GQ867493 1 1,431 Clostridium sordellii (DQ978216) 98
CSG66 GQ867494 1 1,452 Butyricicoccus pullicaecorum (EU410376) 96
CSG72 GQ867499 1 1,440 Eubacterium brachy (Z36272) 92
CSH25 GQ867522 1 1,472 Fusobacterium sp. (EU728711) 98
S7_14 GQ867411 1 1,431 Fusobacterium perfoetens (M58684) 94
S7_17 GQ867413 1 1,453 Fusobacterium perfoetens (M58684) 94
S7_41 GQ867426 1 1,494 Escherichia coli (FJ823386) 96
WSp12 GQ867284 1 1,454 Sutterella stercoricanis (NR_025600) 96
WSp127 GQ867364 1 1,510 Desulfovibrio oryzae (AF273083) 89
WSp143 GQ867378 1 1,441 Clostridium perfringens (Y12669) 99
WSp147 GQ867381 1 1,480 Faecalibacterium prausnitzii (AY169429) 93
WSp151 GQ867384 1 1,465 Clostridium viride (NR_026204) 92
Colonic Microbiota in Arctic and Sub-Arctic Seals 325
Figure 3 Phylogenetic tree of the 39 phylotypes recovered from the
clone library obtained from colon content from three species of seal.
Evolutionary distance was calculated using the Kimura-2 parameter
model for nucleotide change, and the tree was constructed using the
neighbour-joining method. Statistical significance of branching was
verified by bootstrapping. The scale bar represents a 5% estimated
sequence divergence, and reference sequences were obtained from the
GenBank Database. Clones from hooded seal (WSp/S7), harbour seal
(CSH) and grey seal (CSG) libraries
326 T. Glad et al.
Fifteen of the >100 anaerobic ampr isolates observed in one
of five parallels from one hooded were also tested for the
presence of blaTEM alleles by PCR, and all were negative.
Total genomic DNA extracted from hooded seals and
harbour seal contents were all negative when screened
for blaTEM alleles and positive when screened for 16S
rRNA genes. Three of nine parallel total genomic DNA
extractions from grey seal colon content were positive for
blaTEM PCR.
Discussion
This study shows high and novel diversity in the 16S rRNA
gene clone library from colon content in the carnivorous seals.
In total, 39 phylotypes were identified from the combined seal
16S rRNA gene library (Table 4). In a previous study based
on faecal microbial communities of 106 individual mammals
representing 60 species from 13 taxonomic orders, Ley et al.
[34] observed that host diet and phylogeny both influence
bacterial diversity and that carnivorous animals have less
faecal bacterial diversity than herbivorous animals. In
captive carnivores, between 19 and 75 OTUs were
observed, while in herbivorous animals, up to 223 OTUs
were detected. Even though seals were not included in the
study of Ley et al. [34], the findings in this current study
(Figs. 2 and 3; Tables 3 and 4) are consistent with their
observations. However, in our recent study of bacterial
diversity in the faeces from polar bears, another free-ranging
Arctic carnivore, only 17 phylotypes were observed [19].
Table 5 Anaerobic and aerobic colony forming units (log10 cfu/ml) of heterotrophic, ampicillin-resistant and tetracycline-resistant isolates in
colon content from seal
Seal no. Anaerobic countsa Aerobic countsa
Heterotrophic bacteria Ampr Tetr Heterotrophic bacteria Ampr Tetr
Hooded seals
1 9.4±8.9 <1.3 <1.3 5.8±5.1 <1.3 <1.3
2 9.7±9.1b <1.3 <1.3 NC NC NC
3 9.6±8.8 <1.3 <1.3 9.5±9.0b <1.3 2.7±3.0
4 9.4±9.1 <1.3 <1.3 9.2±8.3b 4.2±2.5c 3.5±2.4d
5 10.1±10.0 <1.3e <1.3 9.2±8.5b 2.2±2.2c 3.3±3.2f
6 8.9±8.0 <1.3 NC 8.0±7.0g <1.3 3.5±3.8d
7 10.2±9.6 <1.3 <1.3 9.0±8.3b 2.9±2.5c 3.0±3.0d
8 ND ND ND 8.1±7.5 <1.3 3.2±3.2d
Harbour seal
10 ND ND ND 5.2±4.3h <11.1h ND
Grey seal
11 ND ND ND 4.3±3.0h <11.1h ND
ND not determined, NC not countable
a Mean values are based on five replicates and 72 h incubation
b Mean values are based on 48 h incubation
c Mean values are based on 144 h incubation
d Mean values are based on 96 h incubation
e Mean values are based on four parallels. >100 isolates were observed in the fifth parallel
f Mean values are based on 120 h incubation
g Mean values are based on 24 h incubation
h Mean values are based on log10 cfu/g colon content
Table 6 Density of bacteria and methanogens (log10 cells/g wet wt) in
colon content from hooded seals determined by real-time PCR
Seal no. Bacteria Methanogens
1 12.9 4.3
2 14.0 2.0
4 12.1 3.0
5 12.1 4.2
6 12.7 4.1
7 14.0 ND
8 12.9 3.2
9 12.0 4.0
Mean 12.8±0.8 4.0±0.5
Colonic Microbiota in Arctic and Sub-Arctic Seals 327
Phylotype WSp191 with a sequence identity of 95% to
B. plebeius (Table 4) included as much as 68 (22%) of the
sequences with representatives from all three libraries
(hooded, harbour and grey seal sequences). However, 22
of the 39 phylotypes included sequences from only one of
the libraries, and only four contained sequences from all
three libraries. This indicates that the 16S rRNA gene
libraries from these three Arctic and sub-Arctic seal species
differ, as also visualised in Fig. 2. The sequences obtained
from all three seal species were affiliated with the phyla,
Bacteroidetes (52.7%), Firmicutes (41.5%), Proteobacteria
(4.5%) and Fusobacteria (1.0%) (Fig. 3). The harbour and
grey seal libraries did not contain any Proteobacteria, and
the grey seal library did not have any Fusobacteria.
However, we recognise that these findings might be related
to only single samples from harbour and grey seals were
included. A direct comparison between seal species is not
feasible given the limited number of seals analysed per
species. Likewise, the 313 seal sequences were compared
with 161 polar bear sequences [19]; they were significant
different (p=0.01) for the phyla Bacteroidetes and Proteobacteria
as these were not detected among the polar bear
sequences. The Firmicutes sequences from the seals and the
polar bears were also significantly different. Thirty (77%)
of the 39 phylotypes identified from the colon contents of
the three seal species were <97% related to any known
cultivated species (Table 4). This is in contrast to the
findings in polar bears, where only 23% of the phylotypes
were novel [19]. In studies of gut microbial ecosystems of
other animals, the portion of novel sequences is found to be
even greater than what we observed in the seal 16S rRNA
gene libraries. In the reindeer rumen for instance, as much
as 92% of the bacterial diversity present represented novel
taxonomic groupings [52]. In the rumen of gayals, swamp
buffaloes and Holstein cow, the percentages were 91%,
87% and 76%, respectively [58]. In the intestinal tract of
chickens, 85% of the phylotypes did not have high
sequence similarity to any cultured species [5], and in the
pig gastrointestinal microbiota, 83% of the identified
phylotypes were not likely represented by a known
bacterial species [33].
The anaerobic and aerobic heterotrophic counts in colon
contents from hooded seals were high, ranging from 8.0 to
10.2 log10 cfu/ml, with the exception of one seal in which
the aerobic heterotrophic count was 5.8 log10 cfu/ml.
Compared with the number of aerobic heterotrophic
bacteria from hooded seal samples, the density of bacteria
cultivated from the harbour and the grey seals in this study
was low (Table 5). Cultivation of hooded seal colon content
was done on fresh samples in the field laboratory, whereas
the colon contents from harbour and grey seals were frozen
prior to analysis. There is a potential loss of bacterial
viability when samples are stored before cultivation of
bacteria. Our samples were stored at −70°C without a
cryoprotectant, but previous studies have shown that this
does not lead to a great loss of bacterial number and species
as long as the samples are not repeatedly thawed and
analysed in shorter intervals [1]. However, the harbour and
grey seal samples were stored at less than optimal temperatures
during transport to the laboratory, where they were
then stored at −70°C, but this cannot be excluded as a
reason for this low recovery rate. As expected, the density
of bacteria in the hooded seal colon contents, as determined
by real-time PCR (12.8 log10 cells/g wet wt), was higher
than the results from the cultivation studies because realtime
PCR amplifies DNA from uncultured and lysed/dead
cells. The number of 16S rRNA genes in individual cells
may also influence on the results [49].
Very little is known on the ecology of methanogenic
archaea in the gut of carnivores, particularly wild
carnivores. The mean density of methanogens determined
for the hooded seals in the present study (4.0 log10 cells/g
wet wt) was lower than those observed in the hindgut of
birds like the chicken, ranging from 5.5 to 7.2 log10 16S
rRNA copies/g wet wt caecal contents [45]. In the only
know foregut-fermenting bird, the Hoatzin (Opisthocomus
hoazin), concentrations of methanogens were high
(9.7 log10 cells/g wet wt crop contents) [57], resembling
those reported in ruminants where they are known to vary
with diet and species ranging from 7.7 log10 cells/g wet wt
in the high arctic Svalbard reindeer to 9.1 log10 cells/ml
rumen contents in cattle [13, 50, 51]. A low density of
methanogens in a short and simple colon, presumably with
a short retention time, suggest less time for fermentation in
a small volume by few methanogens, and hence low
methane emissions from our hooded seals. This is in
support of previous data that methane emissions from
monogastric animals are generally lower than those from
ruminants [28].
Compared with hooded seals, both harbour and grey
seals are more likely to have human contact through local
fisheries and fish farms. However, aerobic ampr isolates
were not detected in the samples from harbour and grey
seals. This is consistent with previous findings in faeces
from polar bears [19]. Previously, ampr isolates have been
detected in hooded, harbour and grey seals in the Northwest
Atlantic [6]. In Arctic soils and sediments, the percentage
of ampr isolates has been found to range from 1.7% to
100% of the cultivable bacterial fraction, although blaTEM
alleles were not detected in any of the resistant isolates [8].
In the hooded seal samples, aerobic ampr isolates were
detected in four of the nine colon contents, at less than
0.008%, but blaTEM PCR amplicons were not detected. In
Portugal, blaTEM alleles have been reported in 11% of
faecal samples from wild deer, fox, owl and birds of prey
[11]. The alleles have also been detected in faeces from
328 T. Glad et al.
pigs, dogs and cats [9, 46]. The blaTEM PCR on extracted
total DNA from the hooded and harbour seals were also
negative, and three of the nine parallel extractions from the
grey seal were blaTEM PCR positive. Aerobic tetr isolated
were detected in seven of the nine hooded seal samples, with
proportions less than 0.001% of the cultivable bacterial
fraction. Tetracycline-resistant bacteria have previously been
isolated from the colon content of both wild and domestic
animals, e.g. mice, voles, shrews, swine and from the chicken
cloaca [30, 32, 44]. Resistant bacteria have also been detected
in fish isolates and marine sediment bacteria [22, 53].
In conclusion, the gut microbiota of Arctic and sub-
Arctic seals investigated in their natural environment is
diverse, with sequences representing four bacterial phyla.
The bacterial cell density is high, whereas the prevalence of
ampicillin and tetracycline-resistant isolates is low.
Acknowledgements The authors wish to thank Prof. Arnoldus
Schytte Blix, Prof. Lars P. Folkow and Prof. Karl-Arne Stokkan at
the Department of Arctic and Marine Biology, University of Tromsø,
for the possibility to take part in the expedition to the Greenland Sea
and for their advice and help throughout the expedition. We also thank
Prof. Stokkan for sampling the harbour and grey seals at the coast of
Northern Norway. We are grateful to Dr. Lise Norgård (GenØk-Centre
for Biosafety, Tromsø) for assistance in the field collecting the hooded
seal samples and Korinne Northwood at CSIRO (Brisbane, Australia)
for assistance with real-time PCR. This study was funded by the
Norwegian Research Council and the Roald Amundsen Centre for
Arctic Research (University of Tromsø, Norway).
References
1. Achá SJ, Kühn I, Mbazima G, Colque-Navarro P, Möllby R
(2005) Changes of viability and composition of the Escherichia
coli flora in faecal samples during long time storage. J Microbiol
Meth 63:229–238
2. Amann RI, Ludwig W, Schleifer KH (1995) Phylogenetic
identification and in situ detection of individual microbial cells
without cultivation. Microbiol Rev 59:143–169
3. Berg I, Haug T, Nilssen KT (2002) Harbour Seal (Phoca vitulina)
diet in Vesterålen, North Norway. Sarsia 87:451–461
4. Bigg MA (1981) Harbour seal. In: Ridgeway SH, Harrison RJ
(eds) Handbook of marine mammals, vol. 2. Academic Press,
London, pp 1–27
5. Bjerrum L, Engberg RM, Leser TD, Jensen BB, Finster K,
Pedersen K (2006) Microbial community composition of the
ileum and cecum of broiler chickens as revealed by molecular and
culture-based techniques. Poult Sci 85:1151–1164
6. Bogomolni AL, Gast RJ, Ellis JC, Dennett M, Pugliares KR,
Lentell BJ, Moore MJ (2008) Victims or vectors: a survey of
marine vertebrate zoonoses from coastal waters of the Northwest
Atlantic. Dis Aquat Organ 81:13–38
7. Bonner WN (1981) Grey seal. In: Ridgeway SH, Harrison RJ
(eds) Handbook of marine mammals, vol. 2. Academic Press,
London, pp 111–144
8. Brusetti L, Glad T, Borin S, Myren P, Rizzi A, Johnsen PJ, Carter
P, Daffonchio D, Nielsen KM (2008) Low prevalence of blaTEM
genes in Arctic environments and agricultural soil and rhizosphere.
Microb Ecol Health Dis 20:27–36
9. Carattoli A, Lovari S, Franco A, Cordaro G, Di Matteo P, Battisti
A (2005) Extended-spectrum beta-lactamases in Escherichia coli
isolated from dogs and cats in Rome, Italy, from 2001 to 2003.
Antimicrob Agents Chemother 49:833–835
10. Cole JR, Chai B, Farris RJ, Wang Q, Kulam-Syed-Mohideen AS,
McGarrell DM, Bandela AM, Cardenas E, Garrity GM, Tiedje JM
(2007) The ribosomal database project (RDP-II): introducing
myRDP space and quality controlled public data. Nucl Acids
Res 35:D169–D172
11. Costa D, Poeta P, Saenz Y, Vinue L, Rojo-Bezares B, Jouini A,
Zarazaga M, Rodrigues J, Torres C (2006) Detection of
Escherichia coli harbouring extended-spectrum beta-lactamases
of the CTX-M, TEM and SHV classes in faecal samples of wild
animals in Portugal. J Antimicrob Chemother 58:1311–1312
12. Denman S, McSweeney C (2006) Development of a real-time
PCR assay for monitoring anaerobic fungal and cellulolytic
bacterial populations within the rumen. FEMS Microbiol Ecol
58:572–582
13. Denman S, Tomkins N, McSweeney C (2007) Quantitation and
diversity analysis of ruminal methanogenic populations in
response to the antimethanogenic compound bromochloromethane.
FEMS Microbiol Ecol 62:313–322
14. Ehlers B, Strauch E, Goltz M, Kubsch D, Wagner H, Maidhof H,
Bendiek J, Appel B, Buhk HJ (1997) Nachweis gentechnischer
Veränderungen in Mais mittels PCR. Bundesgesundheitsbl
40:118–121
15. Folkow LP, Martensson PE, Blix AS (1996) Annual distribution
of hooded seals (Cystophora cristata) in the Greenland and
Norwegian Seas. Polar Biol 16:179–189
16. Forster PM, Ramaswamy V (2007) Changes in atmospheric
constituents and in radiative forcing. In: Solomon S, Qin D,
Manning M, Chen Z, Marquis M, Averyt KB, Tignor M, Miller
HL (eds) Climate change 2007: the physical science basis:
contribution of working group I to the fourth assessment report
of the intergovernmental panel on climate change. Cambridge
University Press, Cambridge
17. Furushita M, Shiba T, Maeda T, Yahata M, Kaneoka A, Takahashi
Y, Torii K, Hasegawa T, Ohta M (2003) Similarity of tetracycline
resistance genes isolated from fish farm bacteria to those from
clinical isolates. Appl Environ Microbiol 69:5336–5342
18. Gilliver MA, Bennett M, Begon M, Hazel SM, Hart CA (1999)
Enterobacteria: antibiotic resistance found in wild rodents. Nature
401:233–234
19. Glad T, Bernhardsen P, Nielsen KM, Brusetti L, Andersen M,
Aars J, Sundset MA (2010) Bacterial diversity in faeces from
polar bear (Ursus maritimus) in Arctic Svalbard. BMC Microbiol
10:10. doi:10.1186/1471-2180-1110-1110
20. Glad T, Klingenberg C, Flaegstad T, Ericson JU, Olsvik Ø (2001)
Rapid detection of the methicillin-resistance gene, mecA, in
coagulase-negative staphylococci. Scand J Infect Dis 33:502–506
21. Good IJ (1953) The population frequencies of species and the
estimation of population parameters. Biometrika Trust 40:237–264
22. Guglielmetti E, Korhonen JM, Heikkinen J, Morelli L, Wright Av
(2009) Transfer of plasmid-mediated resistance to tetracycline in
pathogenic bacteria from fish and aquaculture environments.
FEMS Microbiol Lett 293:28–34
23. Hammond PS, Hall AJ, Prime JH (1994) The diet of grey seals
around Orkney and other islands and mainland sites in northeastern
Scotland. J Appl Ecol 31:340–350
24. Haug T, Nilssen KT, Lindblom L (2000) First independent feeding
of harp (Phoca groenlandica) and hooded seals (Cystophora
cristata) pups in the Greenland Sea. NAMMCO Sci Publ 2:29–39
25. Henriksen G, Gjertz I, Kondakov A (1997) A review of the
distribution and abundance of harbour seals (Phoca vitulina), on
Svalbard, Norway, and in the Barents Sea. Mar Mammal Sci
13:157–163
Colonic Microbiota in Arctic and Sub-Arctic Seals 329
26. Henriksen G, Moen K (1997) Interaction between seal and salmon
fisheries in Tana River and Tanafjord, Finnmark, north Norway,
and possible consequences for the harbour seal Phoca vitulina.
Fauna Norvegica Serie A 18:21–31
27. Huber T, Faulkner G, Hugenholtz P (2004) Bellerophon: a
program to detect chimeric sequences in multiple sequence
alignments. Bioinformatics 20:2317–2319
28. Jensen BB (1996) Methanogenesis in monogastric animals.
Environ Monit Assess 42:99–112
29. Kim S-R, Nonaka L, Suzuki S (2004) Occurrence of tetracycline
resistance genes tet(M) and tet(S) in bacteria from marine
aquaculture sites. FEMS Microbiol Lett 237:147–156
30. Kozak GK, Boerlin P, Janecko N, Reid-Smith RJ, Jardine C
(2009) Antimicrobial resistance in Escherichia coli isolates from
swine and wild small mammals in the proximity of swine farms
and in natural environments in Ontario, Canada. Appl Environ
Microbiol 75:559–566
31. Lane DJ (1991) 16S/23S rRNA sequencing. Nucleic acid techniques
in bacterial systematics. In: Stackebrandt E, Goodfellow M
(eds) Modern microbiological methods. Wiley, Chichester, p 133
32. Lapierre L, Cornejo J, Borie C, Toro C, SanMartin B (2008) Genetic
characterization of antibiotic resistance genes linked to class 1 and
class 2 integrons in commensal strains of Escherichia coli isolated
from poultry and swine. Microb Drug Resist 14:265–272
33. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M,
Moller K (2002) Culture-independent analysis of gut bacteria: the
pig gastrointestinal tract microbiota revisited. Appl Environ
Microbiol 68:673–690
34. Ley RE, Hamady M, Lozupone C, Turnbaugh PJ, Ramey RR,
Bircher JS, Schlegel ML, Tucker TA, Schrenzel MD, Knight R,
Gordon JI (2008) Evolution of mammals and their gut microbes.
Science 320:1647–1651
35. Livermore DM (1995) Beta-lactamases in laboratory and clinical
resistance. Clin Microbiol Rev 8:557–584
36. Mazel D, Davies J (1999) Antibiotic resistance in microbes. Cell
Mol Life Sci 56:742–754
37. Mikkelsen B, Haug T, Nilssen KT (2002) Summer diet of grey
seals (Halichoerus grypus) in Faroese waters. Sarsia 87:462–471
38. Mortensson PE, Nordoy ES, Messelt EB, Blix AS (1998) Gut
length, food transit time and diving habit in phocid seals. Polar
Biol 20:213–217
39. Nilssen KT, Haug T (2007) Status of grey seals (Halichoerus
grypus) in Norway. NAMMCO Sci Publ 6:23–31
40. Olsen MA, Nilssen KT, Mathiesen SD (1996) Gross anatomy of
the gastrointestinal system of harp seals (Phoca groenlandica). J
Zool 238:581–589
41. Olsen MA, Aagnes TH, Mathiesen SD (1994) Digestion of
herring by indigenous bacteria in the minke whale forestomach.
Appl Environ Microbiol 60:4445–4455
42. Osterblad M, Norrdahl K, Korpimaki E, Huovinen P (2001)
Antibiotic resistance: how wild are wild mammals? Nature
409:37–38
43. Potelov V, Nilssen KT, Svetochev V, Haug T (2000) Feeding habits
of harp (Phoca groenlandica) and hooded seals (Cystophora
cristata) during late winter, spring and early summer in the
Greenland Sea. NAMMCO Sci Publ 2:40–49
44. Rizzotti L, La Gioia F, Dellaglio F, Torriani S (2009) Molecular
diversity and transferability of the tetracycline resistance gene tet
(M), carried on Tn916-1545 family transposons, in enterococci
from a total food chain. Antonie Leeuwenhoek 96:43–52
45. Saengkerdsub S, Anderson RC, Wilkinson HH, Kim W-K, Nisbet
DJ, Ricke SC (2007) Identification and quantification of methanogenic
archaea in adult chicken ceca. Appl Environ Microbiol
73:353–356
46. Saenz Y, Brinas L, Dominguez E, Ruiz J, Zarazaga M, Vila J,
Torres C (2004) Mechanisms of resistance in multiple-antibioticresistant
Escherichia coli strains of human, animal, and food
origins. Antimicrob Agents Chemother 48:3996–4001
47. Seveno N, Smalla K, van Elsas JD, Collard J-M, Karagouni A,
Kallifidas D, Wellington E (2002) Occurrence and reservoirs of
antibiotic resistance genes in the environment. Rev Med Microbiol
13:15–27
48. Singh G (2004) β-Lactams in the new millennium. Part-I:
monobactams and carbapenems. Mini Rev Med Chem 4:69–92
49. Skillman LC, Toovey AF, Williams AJ, Wright A-DG (2006)
Development and validation of a real-time PCR method to
quantify rumen protozoa and examination of variability between
Entodinium populations in sheep offered a hay-based diet. Appl
Environ Microbiol 72:200–206
50. Sundset MA, Edwards J, Cheng Y, Senosiain R, Fraile M,
Northwood KS, Præsteng K, Glad T, Mathiesen S, Wright ADG
(2009) Molecular diversity of the rumen microbiome of
Norwegian reindeer on natural summer pasture. Microb Ecol
57:335–348
51. Sundset MA, Edwards JE, Cheng YF, Senosiain RS, Fraile MN,
Northwood KS, Præsteng KE, Glad T, Mathiesen SD, Wright ADG
(2009) Rumen microbial diversity in Svalbard reindeer, with
particular emphasis on methanogenic archaea. FEMS Microb Ecol
70:553–562
52. Sundset MA, Præsteng K, Cann I, Mathiesen SD, Mackie RI
(2007) Novel rumen bacterial diversity in two geographically
separated sub-species of reindeer. Microb Ecol 54:424–438
53. Sørum H (1999) Antibiotic resistance in aquaculture. Acta
veterinaria Scand Suppl 92:29–36
54. Wang GC, Wang Y (1997) Frequency of formation of chimeric
molecules as a consequence of PCR coamplification of 16S rRNA
genes from mixed bacterial genomes. Appl Environ Microbiol
63:4645–4650
55. Wang Q, Garrity GM, Tiedje JM, Cole JR (2007) Naive Bayesian
Classifier for rapid assignment of rRNA sequences into the new
bacterial taxonomy. Appl Environ Microbiol 73:5261–5267
56. Woese CR, Kandler O, Wheelis ML (1990) Towards a natural
system of organisms: proposals for the domains Archaea,
Bacteria, and Eucarya. Proc Natl Acad Sci 87:4576–4579
57. Wright A-DG, Northwood KS, Obispo NE (2009) Rumen-like
methanogens identified from the crop of the folivorous South
American bird, the hoatzin (Opisthocomus hoazin). ISME J
3:1120–1126
58. Yang S, Ma S, Chen J, Mao H, He Y, Xi D, Yang L, He T, Deng
W (2009) Bacterial diversity in the rumen of Gayals (Bos
frontalis), Swamp buffaloes (Bubalus bubalis) and Holstein cow
as revealed by cloned 16S rRNA gene sequences. Mol Biol Rep
37:2063–2073
59. Zhu R, Liu Y, Xu H, Ma J, Gong Z, Zhao S (2008) Methane
emissions from three seal animal colonies in the maritime
Antarctic. Atmos Environ 42:1197–1205
330 T. Glad et al.